#!/usr/local/bin/ruby #!/usr/bin/ruby #!/usr/bin/env ruby require 'cgi' require 'AnalyzerOfsiRNA' cgi = CGI.new( "html3" ) ourmRNA = "aauguacguacugacugacugacgcguacguacugaucg" ourmRNA = cgi['mRNASeq'] script = < EOT criteriaChecked = { "one" => "", "two" => "", "three" => "", "four" => "", "annnnnnnnn$" => "" } if ( cgi.has_key?( "criteria" ) ) specifiedCriteria = cgi.params['criteria'] specifiedCriteria.each { |theOne| criteriaChecked[theOne] = 'checked="true"' } else criteriaChecked["one"] = 'checked="true"' criteriaChecked["two"] = 'checked="true"' criteriaChecked["three"] = 'checked="true"' end body = <siRNA Analyzer

Below enter an mRNA string of IUPAC codes. Clicking the "Find siRNAs" button should give you possible sites to which the guide strand might bind.

Sequence

Rules

Antisense begins with A or U
Sense begins with G or C
Antisense 5'-third of sequence is A/U rich (>50%)
No GC stretch over 9bp
10th antisense nucleotide is U

Search Results

EOT explanation = <

Small interfering RNAs (siRNAs) are artificial, 21 to 23 nucleotide, double-stranded RNAs with 3' 2nt overhangs (see diagram below). The base pairing is not always perfect. The mechanism of action is that a protein complex, a RISC (RNA-Induced Silencing Complex), incorporates one of the two strands (called the "guide" or "antisense" strand) preferentially over the other, and this guide strand is used to bind with target mRNAs present in the cytoplasm. The RISC complex responsible for the strong siRNA-mediated knockdown effect is called the catalytic endonuclease-containing complex. When an mRNA hybridizes with the guide strand, the catalytic RISC complex cleaves the mRNA opposite the junction between 10th and 11th nucleotides (starting from the 5' end) of the guide strand. The mRNA fragments are then digested by cellular nucleases, preventing translation into a protein. This is an important post-transcriptional form of gene expression regulation.

For the purposes of this exercise we assume that the sense and antisense strands of the siRNA are perfect complements without any unusual base pairing.

There are various heuristic criteria used to select 21nt sequences to use as siRNAs for a given mRNA. From Ui-Tei et al. Nucelic Acids Res., 32, 936-948:

  1. A/U at the 5' end of the antisense strand;
  2. G/C at the 5' end of the sense strand;
  3. AU-richness in the 5' terminal one-third of the antisense strand; and
  4. the absence of any GC stretch over 9bp in length.

(diagram taken from http://alps3.gi.k.u-tokyo.ac.jp/~yamada/sidirect2/index.php)

EOT analyzer = AnalyzerOfsiRNA.new() checked = cgi.params['criteria'] if ( nil != checked ) checked.each { |condition| if "one" == condition analyzer.add_criterion( condition, &(analyzer.one) ) elsif "two" == condition analyzer.add_criterion( condition, &(analyzer.two) ) elsif "three" == condition analyzer.add_criterion( condition, &(analyzer.three) ) elsif "four" == condition analyzer.add_criterion( condition, &(analyzer.four) ) elsif "annnnnnnnn$" == condition analyzer.add_criterion( condition ) { |theCandidate| theCandidate[11] == "a"[0] } end } end #ourmRNA = "" if ( cgi.has_key?( 'mRNASeq' ) ) ourmRNA = cgi['mRNASeq'] if ( nil == ourmRNA ) ourmRNA = "not cleaned" end ourCleanmRNA = ourmRNA.delete( " \r\n" ) if ( nil != ourCleanmRNA ) ourmRNA = ourCleanmRNA end end results = "" #results += " [#{ourmRNA}]\n" analyzer.analysis( ourmRNA ).sort.each { |x| results += "#{x}: #{' ' * ( (0==x)? 0: ( x - Math.log10( x ).floor ) ) }#{ourmRNA[x,21]}\n" } cgi.out { "\n" + cgi.html { "\n" + cgi.head { cgi.title { "siRNA Analyzer" } + script } + "\n" + cgi.body { body + '
' + results + '
' + "\n" + explanation } + "\n" } + "\n" }